# More than 1 level of indentation in index **URL:** \ **Category:** Elasticsearch\ **Created:** [April 25, 2012, 8:00am UTC](https://discuss.elastic.co/t/more-than-1-level-of-indentation-in-index/7460 "2012-04-25T08:00:16Z")\ **Posts on this page:** 5\ **Page:** 1
**Author:** ![Jerome](https://avatars.discourse-cdn.com/v4/letter/j/a587f6/32.png) [@Jerome](https://discuss.elastic.co/u/Jerome)\ **Post date:** [April 25, 2012, 8:00am UTC](https://discuss.elastic.co/t/more-than-1-level-of-indentation-in-index/7460/1 "2012-04-25T08:00:16Z")
Hi, I have a file with 2 level of indentation : PRIMARY\_TAG TAG : value and i know that ES have just one level : TAG : value Is there a way to index of 2 or more levels. Thanks, Jerome ---
**Author:** ![Igor\_Motov](https://sea2.discourse-cdn.com/elastic/user_avatar/discuss.elastic.co/igor_motov/32/45193_2.png) [@Igor\_Motov](https://discuss.elastic.co/u/Igor_Motov)\ **Post date:** [April 25, 2012, 2:06pm UTC](https://discuss.elastic.co/t/more-than-1-level-of-indentation-in-index/7460/2 "2012-04-25T14:06:23Z")
Elasticsearch, actually, supports multiple levels. Take a look at Object Type [Elasticsearch Platform — Find real-time answers at scale | Elastic](http://www.elasticsearch.org/guide/reference/mapping/object-type.html) On Wednesday, April 25, 2012 4:00:16 AM UTC-4, Jérome wrote: > Hi, > > I have a file with 2 level of indentation : > PRIMARY\_TAG > TAG : value > > and i know that ES have just one level : > TAG : value > > Is there a way to index of 2 or more levels. > > Thanks, Jerome ---
**Author:** ![Jerome](https://avatars.discourse-cdn.com/v4/letter/j/a587f6/32.png) [@Jerome](https://discuss.elastic.co/u/Jerome)\ **Post date:** [April 26, 2012, 10:17am UTC](https://discuss.elastic.co/t/more-than-1-level-of-indentation-in-index/7460/3 "2012-04-26T10:17:46Z")
Thx, I have two question now : For index with multiple levels, in PERL ? $result = $es-\>index( index =\> $index, type =\> $type, id =\> $i, data =\> { id =\> { ACC =\> $num\_acc, DESC =\> $desc, VERSION =\> $version, GI =\> $gi } ORGANISME =\> $espece, CLASSIFICATION =\> $classification, SEQUENCE =\> $seq }, ); And my second question, more important for me is : In PERL, (with the example above), what type is $result ? It's not JSON because i can't decode it with "decode\_json($result)". I want print in a file the result of the operation. When i'm doing a get with pretty=true i've all data on a single line : { "\_index" : "z", "\_type" : "z", "\_id" : "1", "\_version" : 98, "exists" : true, "\_source" : {"SEQUENCE":"CGCCTCCCCAATACCTAATAAGGCATGCGAAATGTTCTCATGAACTACCCCACAACACGCCTAAAACTCAAAACACCCAAAAATATCTCCTCCAATGTCCTGAAACATGAACCCAAAAAGAGACCCACAATAAACTCGTGACTTGTCCCCTCAAAAAAAAAA","CLASSIFICATION":"Eukaryota- > Metazoa-\>Chordata-\>Craniata-\>Vertebrata-\>Euteleostomi-\>Mammalia- > Eutheria-\>Euarchontoglires-\>Primates-\>Haplorrhini-\>Catarrhini- > Hominidae-\>Homo-\>Homo sapiens","DESC":"Homo sapiens FXYD domain > containing ion transport regulator 3 (FXYD3), transcript variant 8, > mRNA.","ACC":"NM\_001136012","ORGANISME":"Homo > sapiens","GI":"209862818","VERSION":"1","keyword":"","comment":"REVIEWED > REFSEQ... I cut it because so looong but i don't understand. How can i have the result with SEQUENCE : ... CLASSIFICATION : ... ... and not in a single line ? On 25 avr, 16:06, Igor Motov [imo...@gmail.com](mailto:imo...@gmail.com) wrote: > Elasticsearch, actually, supports multiple levels. Take a look at Object > Typehttp://www.elasticsearch.org/guide/reference/mapping/object-type.html > > On Wednesday, April 25, 2012 4:00:16 AM UTC-4, Jérome wrote: > > > Hi, > > > I have a file with 2 level of indentation : > > PRIMARY\_TAG > > TAG : value > > > and i know that ES have just one level : > > TAG : value > > > Is there a way to index of 2 or more levels. > > > Thanks, Jerome ---
**Author:** ![Igor\_Motov](https://sea2.discourse-cdn.com/elastic/user_avatar/discuss.elastic.co/igor_motov/32/45193_2.png) [@Igor\_Motov](https://discuss.elastic.co/u/Igor_Motov)\ **Post date:** [April 26, 2012, 5:10pm UTC](https://discuss.elastic.co/t/more-than-1-level-of-indentation-in-index/7460/4 "2012-04-26T17:10:58Z")
pretty=true doesn't format source. Data in the \_source field is always returned as it was indexed. If you want a nicely formated source, just pass entire response though a json formatter. I typically pipe it through python -mjson.tool On Thursday, April 26, 2012 6:17:46 AM UTC-4, Jérome wrote: > Thx, > > I have two question now : > > For index with multiple levels, in PERL ? > > $result = $es-\>index( > index =\> $index, > > ``` > type => $type, > > id => $i, > > data => { > id > > ``` > > =\> { > > ACC =\> $num\_acc, > DESC =\> > $desc, > VERSION > =\> $version, > GI =\> > $gi > } > ORGANISME =\> > $espece, > CLASSIFICATION =\> > $classification, > SEQUENCE =\> > $seq > }, > ); > > And my second question, more important for me is : > > In PERL, (with the example above), what type is $result ? > It's not JSON because i can't decode it with "decode\_json($result)". > > I want print in a file the result of the operation. > When i'm doing a get with pretty=true i've all data on a single line : > > { > "\_index" : "z", > "\_type" : "z", > "\_id" : "1", > "\_version" : 98, > "exists" : true, "\_source" : > {"SEQUENCE":"CGCCTCCCCAATACCTAATAAGGCATGCGAAATGTTCTCATGAACTACCCCACAACACGCCTAAAACTCAAAACACCCAAAAATATCTCCTCCAATGTCCTGAAACATGAACCCAAAAAGAGACCCACAATAAACTCGTGACTTGTCCCCTCAAAAAAAAAA","CLASSIFICATION":"Eukaryota- > > > Metazoa-\>Chordata-\>Craniata-\>Vertebrata-\>Euteleostomi-\>Mammalia- > > Eutheria-\>Euarchontoglires-\>Primates-\>Haplorrhini-\>Catarrhini- > > Hominidae-\>Homo-\>Homo sapiens","DESC":"Homo sapiens FXYD domain > > containing ion transport regulator 3 (FXYD3), transcript variant 8, > > mRNA.","ACC":"NM\_001136012","ORGANISME":"Homo > > sapiens","GI":"209862818","VERSION":"1","keyword":"","comment":"REVIEWED > > REFSEQ... > > I cut it because so looong but i don't understand. How can i have the > result with > SEQUENCE : ... > CLASSIFICATION : ... > ... > and not in a single line ? > On 25 avr, 16:06, Igor Motov [imo...@gmail.com](mailto:imo...@gmail.com) wrote: > > > Elasticsearch, actually, supports multiple levels. Take a look at Object > > Typehttp:// > > [Elasticsearch Platform — Find real-time answers at scale | Elastic](http://www.elasticsearch.org/guide/reference/mapping/object-type.html) > > > > On Wednesday, April 25, 2012 4:00:16 AM UTC-4, Jérome wrote: > > > > > Hi, > > > > > I have a file with 2 level of indentation : > > > PRIMARY\_TAG > > > TAG : value > > > > > and i know that ES have just one level : > > > TAG : value > > > > > Is there a way to index of 2 or more levels. > > > > > Thanks, Jerome ---
**Author:** ![system](https://us1.discourse-cdn.com/elastic/original/3X/1/a/1ac57faf039f6b580b3f104ef42a2a89e41014de.png) [@system](https://discuss.elastic.co/u/system)\ **Post date:** [July 6, 2017, 3:31am UTC](https://discuss.elastic.co/t/more-than-1-level-of-indentation-in-index/7460/5 "2017-07-06T03:31:00Z")