No results when performing wildcard search with query string


#1

Hi ES users,

I'm having issue getting a result when performing wildcard query searching by a char sequence (DNA sequence in my case). It works perfectly for full full-length sequence and with full-length sequence with a leading and ending wildcard. The issue exists only when searching by a sub sequence for which characters were removed from the beginning of full-length sequence.

  1. The following query works fine, result is present (full-length sequence with two wildcards):

    POST /collection/_search
    {
    "from" : 0,
    "size" : 10,
    "query" : {
    "query_string" : {
    "query" : "CTTCGACGTTCAGCTCGTAAACCAGCGACTCCATGCCGTAGTCGGCCTGGGAAATCTGCGTGGCGTTGAAGGTGTTGGTTTCGAGAATATCGGCACCGGCATCCAGATAGGCCTTCTCGATGGCGGCGATCACGTCCGGGCGGCTGAGCAGCAACAAGTCGTTGTTACCCTTCACATCGCTTGGCCAATCGGCAAAACGCGTGCCACGATAGTCGTGTTCCTCCAGACGGTAGCTTTGGATCATAGTACCCATGCCGCCGTCGAGGATCAGGATGCGCTCTTTGAGTGCGTTCTGGAGTGCTTGGAGACGAGCGCTGCGGTCGGACATAGGAACTACCTGGTCGGGCGAATATCAGAAGGTGCCGAATCATAACAAAGCTGCGCGGTTTTTAGGCATGTCGCCCATTTGCATGAAAACTGCTCATGTTGGGCGGGTGGAGGCAGCGCAAGGCACCCAGGACGACCAGGCAACAAATCGTGATGGCTTTCAAGAACCAGGACTTTCCGCACATGGTGCATCGTATCCTTGCCGGCGCCTTCGCCTTGC",
    "default_operator": "and",
    "analyze_wildcard": true
    }
    }
    }

  2. The following query works fine, result is present (part of the sequence removed from the end):

    POST /collection/_search
    {
    "from" : 0,
    "size" : 10,
    "query" : {
    "query_string" : {
    "query" : "CTTCGACGTTCAGCTCGTAAACCAGCGACTCCATGCCGTAGTCGGCCTGGGAAATCTGCGTGGCGTTGAAGGTGTTGGTTTCGAGAATATCGGCACCGGCATCCAGATAGGCCTTCTCGATGGCGGCGATCACGTCCGGGCGGCTGAGCAGCAACAAGTCGTTGTTACCCTTCACATCGCTTGGCCAATCGGCAAAACGCGTGCCACGATAGTCGTGTTCCTCCAGACGGTAGCTTTGGATCATAGTACCCATGCCGCCGTCGAGGA",
    "default_operator": "and",
    "analyze_wildcard": true
    }
    }
    }

  3. The following DOES NOT work, result is NOT present (part of the sequence removed from the beginning):

    POST /collection/_search
    {
    "from" : 0,
    "size" : 10,
    "query" : {
    "query_string" : {
    "query" : "GGAGACGAGCGCTGCGGTCGGACATAGGAACTACCTGGTCGGGCGAATATCAGAAGGTGCCGAATCATAACAAAGCTGCGCGGTTTTTAGGCATGTCGCCCATTTGCATGAAAACTGCTCATGTTGGGCGGGTGGAGGCAGCGCAAGGCACCCAGGACGACCAGGCAACAAATCGTGATGGCTTTCAAGAACCAGGACTTTCCGCACATGGTGCATCGTATCCTTGCCGGCGCCTTCGCCTTGC",
    "default_operator": "and",
    "analyze_wildcard": true
    }
    }
    }

Any ideas why I'm getting an empty result for 3rd query?

Thanks,
Krzysztof


(system) #2